|
  
Molecular Cloning and Characterization of the TaLon1 in wheat
Li-Ke Liu1, Xiao-Li Guo2 , Dong-Cheng Liu1, Hua-Bo Wang1 and Ai-Min Zhang1
1 Institute of Genetics and Developmental Biology, Chinese Academy of Science, Beijing 100101
2. College of Biology, China Agricultural University. Beijing 100094
Author for correspondence e-mail: amzhang@genetics.ac.cn
Abstract
In yeast and human, the ATP-dependent Lon protease plays an important role in removal of the abnormal proteins and maintaining mtDNA integrity. In this paper, using RT-PCR and RACE techniques, we isolated a gene in wheat that encodes a product belonging to the Lon protease family. This gene, designated as TaLon1, is predicted to encode an 886 amino acid protein. TaLon1 shows a constitutive expression pattern in wheat, which indicates that the TaLon1 plays a housekeeping role in wheat. Like its counterpart in yeast, it may degrade abnormal proteins in mitochondria and maintain the mtDNA integrity. Unlike the lon gene in yeast and E. coli, the TaLon1 does not respond to heat-shock at 42 °C. Under salt stress, the TaLon1 expressions decline after treatment at both 150 m mol/L and 250 m mol/L NaCl for 24h. Given its important roles in yeast and E. coli, the salt stress damages to plant may be partly interpreted by the decrease of the TaLon1 expression. It has been demonstrated that the Lon protease has some effects on cytoplasmic male sterility (CMS) in common bean. But in wheat, there is no difference in TaLon1 expression between K-CMS line and normal lines.
Keyword
Lon protease, protein degradation, Triticum aestivum L, cytoplasmic male sterility
Protein degradation plays a variety of roles in all organisms. Protein degradation is an important mechanism of regulating gene expression and responsible for removal of damaged or abnormal proteins. Much of the protein degradation is performed by ATP-dependent proteases in bacteria, of which the Lon (also called La) in E. coli is one of the best characterized (Gottesman, 1996). The Lon protein is made up of four identical subunits of 87kDa(Goldberg et al, 1994). Each subunit carries a typical ATP-binding motif and a proteolytic domain with a catalytically active serine residue (Chin et al, 1988; Amerik et al, 1991; Fisher and Glockshuber, 1993) and plays a primary role in the degradation of many abnormal proteins as well as unstable regulatory proteins in bacteria (Mizusawa and Gottesman, 1983; Maurizi , 1987; Sonezaki et al, 1995; Wright et al, 1996; Liu et al, 1999).
In yeast a lon counterpart, PIM1, was cloned (Van Dyck et al, 1994; Suzuki et al, 1994) which was essential for removing abnormal proteins, selective proteolysis in matrix, maintaining mtDNA integrity and respiration-dependent growth.
Sarria et al(1998) and Barakat et al(1998) firstly isolated the lon homologous genes in Arabidopsis and Zea mays respectivly, the first ones in plant species. Similar to the counterpart in yeast, the AtLon in Arabidopsis could degrade the abnormal protein encoded by pvs-orf239 in common bean mitochondria in vitro, which is considered the cause of the cytoplasmic male sterility (CMS)(Sarria et al, 1998). This indicates that the lon gene in plant mitochondria may play an important role in CMS.
In this paper, we cloned a lon homologous gene in common wheat (Triticum aestivum L.) and characterized its expression pattern in different tissues and the responses to heat-shock and salt stress. Furthermore, the possible relationship of Lon protease and Aegilops kotschyi Bioss cytoplasm male sterility (K-CMS) in wheat was discussed.
Materials and methods
Material preparation
The anthers of common wheat K-CMS line 5418A, maintainer line 5418B, restorer line Shan 229 and hybrid (5418A×Shan 229) were harvested on ice and frozen in liquid nitrogen, then stored at -80℃.
Seeds of 5418B were surface sterilized with NaClO solution (effective chloride concentration 2.0%). After germinated in Petri dish, the seeds were grown hydroponically in full strength Hoagland medium in greenhouse (16/8 h daily light period, 25 °C temperature (night/day) and 60 to 70 % relative humidity). Two-week-old seedlings were transferred to fresh Hoagland medium supplemented with 150m mol/L NaCl and 250m mol/L NaCl. After exposure to the salt stress treatments for 7h and 24h, roots were collected and frozen with liquid nitrogen and stored at –80°C until further processed. At the same time, the heat-shock was carried out by transferring the two-week-old seedlings to 42 °C fresh Hoagland medium and keeping for 90min in a 42 °C oven. The roots and shoots were collected and treated as above.
RNA extraction
Total RNA was extracted with Trizol reagent (Invitrogen) according to the manufacturer's instructions. Reverse transcription was carried out in a 25μl reaction containing 2μg total RNA, 0.5μg M13APN(5'gtt ttc cca gtc acg act ttt ttt ttt ttt tt nn3'), 0.5m mol/L each dATP, dCTP, dTTP and dGTP(each to 0.5m mol/L final concentration), 20U RNase Inhibitor (Takara), 200U M-MLV reverse transcriptase (Promega). The reaction was performed at 42℃ for 1h and subsequently diluted to 100ul.
Homologous cloning of the lon homologous gene in wheat
With the nucleotide sequence of maize Lon1 gene, BLASTN against wheat EST database was performed on http://wheat.pw.usda.gov/west. The primers 5’upper-1 (5'ttccgccagccgtacacagcacac3') and 5’lower-1 ( 5'accagcaggaaaatgtatgtg(a/g)a3') were designed based on the putative nucleotide sequence of wheat lon 5’ part for RT-PCR. According to the sequence of lon 5’part, two lon3’ nested upper primers (lon 3’upper1 5’gtggtgaagttgaaatggaagtta3’ lon3’upper2 5’tcgcctatgattgttgatgag3’) were designed. With the M13PM4 (5'gtt ttc cca gtc acg ac3’) as the lower primer, the 3' Rapid Amplification of cDNA Ends (RACE) PCR was used to obtain the lon 3’ part. A 1.1kb fragment was harvested and sequenced. Assembly of the two fragments was performed and a complete coding sequence of lon homolog in wheat was obtained.
Results
Cloning TaLon1 complete coding sequence
Using RT-PCR and RACE technique, we got the full coding sequence of lon homologous gene in wheat, designated as TaLon1 (GenBank accession number: AY494984). Sequence analysis shows that TaLon1 encodes an 886 amino acid protein with a predicted molecular weight of 97.6kDa. A very conserved ATP binding domain, so called Walker A sequence, in both prokaryote and eukaryote (Walker et al, 1982) was located at 410-418 residues.
To further explore the relationship of TaLon1 to other related proteins, a phylogenetic analysis was carried out with CLUSTAL W on http://www.ebi.ac.uk/, the TaLon1 is closer to those of eukaryotic organisms than to those of bacteria.
Interestingly, there are more than one lon homologs in some species. Two lon homologs, Lon1 and Lon2, exist in maize (Barakat et al, 1998). While high similarity (94%) is present between TaLon1 and maize Lon1, the similarity between TaLon1 and maize Lon2 is only 40%. The same results happened when TaLon1 was compared to Lon1 and Lon2 in Arabidopsis.
TaLon1 expression pattern in anthers
With the tublin expression as internal control, we examined TaLon1 expression pattern in anthers of different materials at different developmental stages.

TaLon1
Tublin
Figure1 TaLon1 expression pattern in anthers. 1-4: the anthers at tetrad stage; 5-8: the anthers at mononucleate stage; 9-12: the anthers at binucleate stage.1,5,9: the anthers of 5418A; 2,6,10:the anthers of 5418B; 3,7,11: the anthers of 5418F1;4,8,12: the anthers of shaan229
The TaLon1 expression shows no significant difference in different materials and at different developmental stages (Figure 1). As a whole, the TaLon1 expression in tetrad stage was slightly lower than those of other two stages. This may be a result of the more active metabolism existing at the mononucleate and binucleate stages.
Expression of TaLon1 in response to heat-shock

TaLon1
Tublin
Figure 2 Expression of TaLon1 in response to heat-shock. 1, treated roots; 2, treated shoots; 3, control roots; 4, control shoots.
In yeast and E. coli, the lon gene can be induced by heat-shock (Goff et al, 1984; Van Dyck et al, 1994). To determine whether the TaLon1 is induced by heat-shock, 5418B seedlings were treated at 42℃ for 90min. As above, the RT PCR was performed. The results indicated that TaLon1 expressions were at comparable levels in all of these tissues (Figure 2). Taken together with the results of TaLon1 expressions in anthers, we can conclude that the TaLon1 is constitutively expressed in all tissues and developmental stages.
TaLon1 expression under salt stress

TaLon1
Tublin
Figure 3 TaLon1 expressions under salt stress. 1, control, treated for 7h; 2, treated for 7h at 150 m mol/L NaC l; 3, treated for 7h at 250 m mol/L NaCl; 4, control, treated for 24h; 5, treated for 24h at 150 m mol/L NaCl; 6, treated for 24h at 250 m mol/L NaCl
In Bacillus subtilis, the amount of lon-specific mRNA is increased after salt stress (Riethdorf et al, 1994). To explore whether TaLon1can also respond to the salt stress, the treatment at 150 m mol/L and 250 m mol/L NaCl for 7 and 24h respectively was carried out. RNA extraction and RT PCR were done as above. As shown in Figure 3, the expressions of TaLon1 show no difference between the control and those treated for 7h at both NaCl concentrations. But after treated for 24h, TaLon1 expression decreased at both NaCl concentrations compared to the controls, especially at 250m mol/L.
Discussion
Based on the important roles of Lon protease in yeast mitochondria, we isolated a lon homologous gene in wheat designated as TaLon1. Unlike the lon gene in yeast (Van Dyck et al, 1994; Suzuki et al, 1994) and human (Wang et al, 1993), no typical mitochondrial targeting presequence was found at the N terminus of TaLon1. For the location of the TaLon1 in cell, there are three possibilities. Firstly, TaLon1 is really a mitochondrial protein, but it does not contain a common mitochondrial targeting presequence, as has been demonstrated for some mitochondrial proteins (Braun et al, 1994; Braun and Schmitz, 1995a, 1995b). Secondly, the TaLon1 contains a new type of mitochondrial presequence, since the mitochondrial targeting presequences are greatly various among the mitochondrial targeting proteins (Whelan and Glaser, 1997). In Arabidopsis, immunoblot analysis demonstrates that the lon homologs exist in both chloroplast and mitochondria (Adam et al, 2001). Furthermore, Olsen demonstrated that AtLon2 (GenBank accession number: At5g47040) was localized to peroxisome in Arabidopsis(Olsen, personal communication). Then, thirdly, the TaLon1 may not be targeted to mitochondria but to other organelles. For further research, a transient expression system may be able to help us to determine its location in wheat cell.
It is interesting that more than one homolog were found in maize (Barakat et al, 1998) and Arabidopsis (Adam et al, 2001). This may indicate that during evolution, along with the organelle evolution, the lon gene also evolved into different homologs localized to different organelles to function as a protease in eukaryote.
Like the Lon1 in maize (Barakat et al, 1998), TaLon1 shows a constitutive expression pattern in roots, leaves and anthers. This indicates that the TaLon1 is an important gene playing a housekeeping-like role in wheat, i.e. similar to PIM1 in yeast, whose product may degrade abnormal proteins in mitochondria and maintain the mtDNA integrity.
Under salt stress, the TaLon1 transcripts levels declined after treated for 24h at both 150 m mol/L and 250m mol/L NaCl. Given the important roles of lon gene in E. coli and yeast, the salt stress damages to plant may partly due to the decrease of the lon gene expression.
In this paper, no expression difference of TaLon1 was present between K-CMS line and normal lines. But we can’t exclude that there are some other TaLon1 homologs in wheat that possess a different expression pattern between K-CMS line and normal lines in wheat.
Acknowledgement:
This research was supported by national nature science foundation of China (300250030)、Chinese 863 program(2002AA207004) and the program of Chinese academy of sciences(KSCX2-SW-304).
References
Adam Z, Adamska I, Nakabayashi K, Ostersetzer O, Haussuhl K, Manuell A, Zheng B, Vallon O, Rodermel S R, Shinozaki K, Clarke A K. 2001. Chloroplast and mitochondrial proteases in Arabidopsis. A proposed nomenclature. Plant Physiol, 125(4): 1912-8
Amerik A Y, Antonov V K, Gorbalenya A E, Kotova S A, Rotanova T V, Shimbarevich E V. 1991. Site-directied mutagenesis of La protease. FEBS Lett, 287:211-214
Barakat S, Pearce D A, Sherman F, Rapp W D. 1998. Maize contains a Lon protease gene that can partially complement a yeast pim1-deletion mutant. Plant Mol Biol, 37(1): 141-154.
Braun H P, Jänsch L. Kruft V,Schmitz U K. 1994. The ‘Hinge’protein of cytochrome c reductase from potato lacks the acidic domain and has no cleavable presequence. FEBS Lett, 347:90-94.
Braun H P, Schmitz U K. 1995a. Molecular structure of the 8.0 kDa subunit of cytochrome-c reductase and its ΔΨ-dependent import into isolated mitochondria. Biochim Biophys Acta, 1229:181-186
Braun H P, Schmitz U K. 1995b. Molecular features and mitochondrial import pathway of the 14 kilodalton subunit of cytochrome c reductase from potato. Plant Physiol, 107:1217-1223
Chin D T, Goff S A, .Webster T, Smith T, Goldberg A L. 1988. Sequence of the lon gene in Escherichia coli. A heat-shock gene which encodes the ATP-dependent protease La. J Biol Chem, 263(24): 11718-11728
Fisher H, Glockshuber R. 1993. ATP hydrolysis is not stoichiometrically linked with proteolysis in the ATP-dependent protease La from Escherichia coli. J Biol Chem, 268:22502-22507
Goff S A, Casson L P, Goldberg A L. 1984. Heat shock regulatory gene htpR influences rates of protein degradation and expression of the lon gene in Escherichia coli. Proc Natl Acad Sci U S A, 81(21): 6647-6651.
Goldberg A L, Moerschell R P, Chung C H, Maurizi M R. 1994. ATP-dependent protease La (lon) from Escherichia coli. Methods Enzymol, 244:350-375
Gottesman S. 1996. Proteases and their targets in Escherichia coli. Annu. Rev. Genet, 30:465-506
Liu J, Cosby W M, Zuber P. 1999. Role of lon and ClpX in the post-translational regulation of a sigma subunit of RNA polymerase required for cellular differentiation in Bacillus subtilis. Mol Microbiol, 33(2): 415-28.
Maurizi, M. R. 1987. Degradation in vitro of bacteriophage lambda N protein by Lon protease from Escherichia coli. J Biol Chem, 262(6): 2696-703
Mizusawa S, Gottesman S. 1983. Protein degradation in Escherichia coli: the lon gene controls the stability of sulA protein. Proc Natl Acad Sci U S A, 80(2): 358-362
Riethdorf S, Volker U, Gerth U, Winkler A, Engelmann S, Hecker M. 1994. Cloning, nucleotide sequence, and expression of the Bacillus subtilis lon gene. J Bacteriol, 176(21): 6518-6527.
Sarria R, Lyznik A, Vallejos C E, Mackenzie S A. 1998. A cytoplasmic male sterility-associated mitochondrial peptide in common bean is post-translationally regulated. Plant Cell, 10(7) :1217-1228
Sonezaki S, Ishii Y, Okita K, Sugino T, Kondo A, Kato Y. 1995. Overproduction and purification of SulA fusion protein in Escherichia coli and its degradation by Lon protease in vitro. Appl Microbiol Biotechnol ,43(2): 304-309
Suzuki CK, Suda K, Wang N, Schatz G. 1994. Requirement for the yeast gene LON in intramitochondrial proteolysis and maintenance of respiration. Science, 264:273-276
Van Dyck L, Pearce DA, Sherman F. 1994. PIM1 encodes a mitochondrial ATP-dependent protease that is required for mitochondrial function in the yeast Saccharomyces cerevisiae. J Biol Chem., 269:238-242
Walker J E, Saraste M, Runswick M J, Gay N J. 1982. Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J, 1(8): 945-951.
Wang N, Gottesman S, Willingham M C, Gottesman M M, Maurizi M R. 1993. A human mitochondrial ATP-dependent protease that is highly homologous to bacterial Lon protease. Proc Natl Acad Sci U S A, 90(23): 11247-11251.
Whelan J and Glaser E. 1997. Protein import into plant mitochondria. Plant Mol. Biol, 33:771-789
Wright R, Stephens C, Zweiger G, Shapiro L, Alley M R. 1996. Caulobacter Lon protease has a critical role in cell-cycle control of DNA methylation. Genes Dev, 10(12): 1532-42.   
|
|