1International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Andhra Pradesh 502 324, India 2International Institute for Tropical Agriculture (IITA), Ibadan, Nigeria
3Central University of Hyderabad, Andhra Pradesh, India
4International Centre for Genetic Engineering and Biotechnology (ICGEB), New Delhi, India
Additional simple sequence repeat (SSR) markers for pearl millet (Pennisetum glaucum) will facilitate application of marker-assisted breeding in this orphan crop. We attempted to develop additional SSR markers using freely available sequence information from 2494 expressed sequence tags (ESTs) from root and shoot tissues of pearl millet seedlings exposed to cold, drought and salt stresses. EST sequences were analyzed for the presence of SSRs using the ‘Tandem Repeat Finder’ program and 410 SSR sequences were detected. Using the ‘Primer3’ program, primer pairs could be designed for 282 of these 410 SSR motifs. Visual scanning to select those most likely to be polymorphic (based on repeat numbers) in di-, tri-, and tetra-nucleotide repeat classes was followed by synthesis of 38 unique primer pairs. These were tested for amplification and polymorphism using DNA from ICMB 841 and 863B, the parents of an ICRISAT pearl millet mapping population. Clear amplification products were obtained for 25 primer pairs. Of these, 13 detected polymorphism between the two elite seed parent maintainer lines. Three primer pairs did not work and PCR conditions for the remaining 10 primer pairs need to be optimized to improve amplification specificity. The 13 polymorphic SSR markers are being added to the pearl millet framework map, and being used in assessments of genetic diversity among elite inbred lines. We will test a small number of additional primer pairs from the initial set of 282 candidates, and will repeat this procedure as and when additional pearl millet EST sequences are made publicly available.
Key words
Pennisetum glaucum, microsatellites, EST
Introduction
Pearl millet [Pennisetum glaucum (L.) R. Br.] is the stable food and fodder crop of millions of poor people living on the most marginal agricultural lands of Africa and the Indian subcontinent. Indeed, in some of the hottest and driest regions where agriculture is possible in India and Africa pearl millet is the only cereal that can be grown under dryland conditions and so plays a critical role in food security. However, people living in these regions have not yet benefited from the current ‘biotechnology revolution’, or even the ‘green revolution’ that dramatically increased food grain production on irrigated lands over a generation ago. In recent times, the use of molecular marker technology for the genetic improvement of pearl millet has made some headway, and pearl millet has been elevated to the status of a molecular crop thanks to a series of collaborative projects involving John Innes Centre (JIC) and ICRISAT supported by the Plant Sciences Research Programme of the UK’s Department for International Development (Hash and Bramel-Cox, 2000; Breese et al., 2002). The first major milestone was achieved in 1993 with the creation of a genetic linkage map of the pearl millet genome with 181 restriction fragment length polymorphism (RFLP) markers—the marker system of choice in the early 1990s (Liu et al., 1994). Now more than 600 molecular markers have been created and mapped for pearl millet, a more detailed linkage map has been produced, and quantitative trait loci (QTL) for disease resistance (Jones et al., 1995 2002; Morgan et al., 1998), drought tolerance (Yadav et al., 2002, 2004), flowering time and grain and stover yield (Yadav et al., 2003), and ruminant nutritional quality of straw (Hash et al., 2003) have been mapped. These genetic tools for marker-assisted breeding of pearl millet are now in place and available for anyone to use in improving pearl millet hybrids and to extend the economic lifespan of elite hybrid parental lines. However, application of these discoveries is hampered by the limited availability of repeatable, polymorphic PCR-compatible markers in pearl millet. Although ICRISAT and its partners have successfully demonstrated the use of RFLP markers in the transfer of downy mildew resistance and enhanced terminal drought tolerance, these markers are too labor-intensive and high cost for applied use, as well as having potential health and environmental hazards. Thus RFLP markers are not considered suitable for large-scale genotyping applications in an applied plant breeding program. For plant breeding applications, PCR-compatible markers based on microsatellites or simple sequence repeats (SSRs) are often considered the most appropriate. SSRs typically provide single-locus markers, which are often co-dominantly inherited and characterized by hypervariability, abundance and reproducibility. However, development of SSR markers is expensive as it requires a substantial investment in DNA sequencing. To date, circa 100 SSR markers are available for use in pearl millet (Qi et al., 2001; Allouis et al., 2001; Budak et al., 2003; Qi et al., personal communication), but a much larger number is required for their application in plant breeding. Therefore, development of additional SSR markers is a valuable objective for the pearl millet research community. In the past, SSRs have been expensive to develop and this has largely limited their application to the more commercially important crops. Enrichment protocols have been used to reduce these costs by focusing sequencing efforts on DNA clones that are likely to contain a particular repeat motif (e.g., Budak et al., 2003). Recently however, an alternative source of microsatellites has been utilized. Discovery of microsatellites in Expressed Sequence Tags (ESTs) provides the opportunity to develop SSR markers in a simple and direct way, i.e., by electronic searches (data mining) of EST databases. Exploitation of this source of SSR markers is obviously limited to the species for which EST sequence information is available. This specific approach was first attempted in rice (Miyao et al., 1996) and has subsequently been reported from many other crops. We report here the development of a set of SSR markers from pearl millet EST sequences recently submitted to GenBank.
Materials and methods
Recently, 2494 EST sequences form pearl millet root and shoot tissues of seedlings exposed to cold, drought and salinity stresses have been submitted to the National Center for Biotechnology Information (NCBI) GenBank data base (MK Reddy, personal communication; accession numbers 32275159-32277652). This sequence information in FastA format was analysed for repeat patterns using the ‘Tandem repeat finder’ program (Benson, 1999) for all possible di-, tri-, tetra-, and penta-nucleotide repeats. ESTs that contained SSRs were labeled and the exact location of the SSR within an EST was annotated together with the repeat unit and microsatellite size information. PCR primer pairs based on flanking sequences of each SSR were designed using the ‘Primer3’ program (Whitehead Institute for Biological Research). Visual scanning of these putative SSRs and their primer sequences to select those most likely to be polymorphic (based on repeat numbers) in di-, tri-, and tetra-nucleotide repeat classes was followed by synthesis of 38 unique primer pairs. These 38 SSR primer pairs were tested on genomic DNA isolated from the parents of an ICRISAT pearl millet mapping population based on the cross of elite seed parent maintainer lines ICMB 841 and 863B (Yadav et al., 2003, 2004).
DNA was extracted from seedling leaf tissues using the phenol-chloroform method. PCR conditions for screening the SSR primers were as follows: 10-15 ng of template DNA, 1.5 mM of MgCl2, 0.5-1.0 pM of each primer, 0.2 mM of dNTPs, 1 μL of 10X NH4 buffer (Bioline), and 0.5 units of BIOTAQ® DNA polymerase (Bioline). Reaction volumes were 10 μL, and these were cycled at 94°C for 1 min, 48-61°C for 1 min (specific to the primer pair used; see Table 1 below), and 72°C for 1 min, repeated for 35 cycles on a Perkin Elmer 9700 thermocycler. PCR amplification produced were resolved and scored on 6% polyacrylamide gels with silver staining.
Results and discussion
In this study the ‘Tandem repeat finder’ program was used to identify SSR sequences from 2494 ESTs that had recently been submitted to a public database. The program identified 410 SSR-containing ESTs, which was a higher frequency (16% of ESTs) than expected based on reports from other crops. The relative abundance of di-, tri-, tetra- and penta-nucleotide repeat motifs was 162 (40%), 96 (23%), 131 (32%), and 21 (5%), respectively. Among the di-nucleotide motifs, GA/CT was the most abundant—as reported in many other crops. The GA/CT motif can represent codons GAG, AGA, UCU, and CUC in mRNA populations and translate into the amino acids Arg, Glu, Ala, and Leu, respectively. Ala and Leu are present in high frequencies in proteins and this could be one of the reasons that GA/CT motifs are found in such high frequencies in EST collections (Kantety et al., 2002).
From the 410 SSR motifs identified, we could design primer pairs for 282. Although the EST sequences used were thought to be unique, there was some degree of redundancy in the SSR motifs identified and in the primer pairs designed (circa 7%). This was probably due to a low frequency of mis-identified bases in the EST sequences. Initially we synthesized 38 non-redundant primer pairs and tested these for amplification using DNA of elite pearl millet inbred maintainer lines (and mapping population parents) ICMB 841 and 863B. In total, 25 primer pairs amplified unambiguous PCR products and 13 of these detected polymorphism between two genetically diverse elite hybrid parental lines (comparable to the level of polymorphism detected by pearl millet SSRs from JIC in these parents). Three primer pairs failed to produce amplification products and PCR conditions for the remaining 10 primer pairs need further optimization. Primer sequences, polymorphism, annealing temperature, and expected product size for the 25 functional primer pairs are given in Table 1.
The proportion of polymorphic primers was highest for di-nucleotide repeats and least for tetra-nucleotide repeats. It has been reported that EST-derived SSRs are less polymorphic than those derived from genomic libraries. However, EST-SSRs represent a unique opportunity to exploit existing sequence information and bypass creation and sequencing of SSR-enriched (or random) genomic libraries. Perhaps the most important feature of EST-SSRs is that the primer pairs designed for them are more likely to function in distantly related species than are SSR primer pairs derived from genomic libraries. This makes EST-SSRs potentially more useful for comparative mapping studies (Kantety et al., 2002). Once mapped, EST-SSRs provide map locations for the genes that carry them.
The frequency of SSR-containing ESTs was quite high in this initial sample of the expressed portion of the pearl millet genome, so it appears that this approach can add reasonable numbers of SSRs to the existing pearl millet SSR collection at very modest cost provided that 1) the sequence information is freely available as a result of other research programs, 2) care is taken to minimize redundancy, and 3) primer synthesis and testing is limited to only sequences flanking the most highly repeated di-, tri-, and tetra-nucleotide motifs.
Table 1. Details of SSR primers developed from pearl millet EST sequences
Name1 |
Forward primer sequence (5’ – 3’) |
Reverse primer sequence (5’ – 3’) |
Repeat |
P2 |
T3 (°C) |
S4 (bp) |
3002 |
AAAGTTACCGGGAGGGTAAAAA |
TCGCCTAAAAACTGGAGGAA |
AAAC(3) |
P |
61 |
205 |
3005 |
CGCGGTGTTCTCACACAC |
TGTGAATTCCGCGGGTATAG |
AC(14) |
M |
48 |
140 |
3006 |
AAATCGGTCGTGGTGAAGTT |
GAGAATGTGGGAGACACACG |
AC(16) |
M |
52 |
180 |
3009 |
CTGTACCATGTGCGCTGATT |
GCGCATATATGTGGGTGTGT |
AC(16) |
P |
48 |
320 |
3011 |
CACGCCCTTTTTACCTTGAC |
CGCGACACGTCCTACACTAA |
AC(21) |
P |
48 |
150 |
3013 |
TGTGGGAGAGAGGAGAGTCC |
CGCGAGATGATGTGTGGT |
AC(33) |
P |
61 |
370 |
3014 |
TGCTTCACAGCCTCTCCATA |
CCACCATGCAACAGCAATAA |
ACC(8) |
M |
55 |
280 |
3016 |
TTGTGGCTGAAGAAGAGATCC |
AATGTGGGGAGAGACACACG |
CA(17) |
P |
45 |
450 |
3017 |
CACCAAACAGCATCAAGCAG |
AGGTAGCCGAGGAAGGTGAG |
CAG(7) |
P |
52 |
200 |
3018 |
CGATGACACCTGTGCGTATT |
ATCGAACTGCACGTTAGCAA |
CATG(4) |
M |
61 |
215 |
3019 |
GCGCACCACCTGTGTCTAT |
CATGCAGAGAAAAATCAAGCA |
CGTA(4) |
M |
48 |
210 |
3020 |
GTTCCATGGAGCTGGAAGTC |
GCTAGAACAGGGCCGTTACA |
CGTG(5) |
M |
58 |
180 |
3021 |
GCCGACAGGAAGATTACGAT |
AGCAAAACGCAGAACAACAG |
CGTG(5) |
M |
58 |
175 |
3022 |
CTGGAAGTCCTTCTCGGTTG |
CTGCTCCGCTCTGAATCTG |
CGTG(5) |
M |
58 |
190 |
3025 |
GTTGCAGATGAGCGATCGTA |
AGCGCAAAGAGTGTAACTTGG |
CTC(6) |
M |
58 |
180 |
3026 |
GTGAGGCCTCGAACAAACAC |
GCCGACCAAGAACTTCATACA |
CTC(6) |
M |
58 |
130 |
3027 |
ACACCATCACCGACAACAAA |
AGTGACCTGGGGTACAGACG |
GAT(6) |
P |
61 |
210 |
3028 |
ACGATTCTTCGTCGTTCCAG |
ATACGATACGCGCGAGCTAC |
GATC(4) |
M |
58 |
170 |
3029 |
ACCAGCAACAGCAGCAGAG |
ACACACTGCGACAAGTGGAG |
GCA(6) |
P |
48 |
260 |
3032 |
AGGTAGCCGAGGAAGGTGAG |
CAACAGCATCAAGCAGGAGA |
GCT(8) |
P |
61 |
190 |
3033 |
GAGGGCCAGCTCTCCTAGAT |
CCCTAACCACAGAGGGACAC |
TGCC(4) |
P |
58 |
220 |
3035 |
GCCAAGGAGGTCAAGATCG |
ACACGACTCGACTCAGACCA |
TGCC(4) |
P |
58 |
280 |
3037 |
CGTCGCTGCTCTTTCTTCTT |
ATTTCAGAAACGGCAACCAA |
TGGA(4) |
M |
58 |
200 |
3038 |
CTCTCGGTTTGACGGTTTGT |
GGGGAAAACAAAGTTGCTCA |
TGT(6) |
P |
58 |
180 |
3039 |
GGCACGAGGGGCTAAGTAA |
GGAACGCCGAGTACACAGAT |
TGT(6) |
P |
61 |
180 |
1 Each SSR primer number in this column is preceded by the prefix ‘ICMP’ for ICRISAT millet primer
2 Polymorphism: P = ICMB 841 and 863B are polymorphic; M = ICMB 841 and 863B are monomorphic
3 Annealing temperature 4 Expected PCR product size
This study has demonstrated potential utility of EST-derived SSR primers in pearl millet. As reported for other crops, EST-derived SSRs provide a cost-saving marker development option in pearl millet. We plan to synthesize and test primer pairs for additional candidate EST-SSRs based on the available pearl millet sequence data. Those capable of generating PCR products will be tested for their polymorphic information content, and any detected polymorphism will be mapped. We also propose to develop additional pearl millet EST libraries and use their sequence information to identify additional EST-SSRs.
Acknowledgement
This document is an output from a project funded by the UK Department for International Development (DFID) for the benefit of developing countries. The views expressed are not necessarily those of DFID.
References
Allouis S, Qi X, Lindup S, Gale MD, Devos KM (2001). Construction of a BAC library of pearl millet, Pennisetum glaucum. Theoretical and Applied Genetics 102, 1200-1205.
Benson G (1999). Tandem repeats finder: a program to analyse DNA sequences. Nucleic Acids Research 27, 573-580.
Breese, WA, Hash CT, Devos KM, Howarth, CJ (2002). Pearl millet genomics – an overview with respect to breeding for resistance to downy mildew. In: “Sorghum and Millets Pathology 2000” (Ed. Leslie JF). pp 243-246 (Ames, Iowa, USA: Iowa State Press).
Budak H, Pedraza F, Cregan PB, Baenziger PS, Dweikat (2003). Development and utilization of SSRs to estimate the degree of genetic relationships in a collection of pearl millet germplasm. Crop Science 43, 2284-2290.
da Silva JAG (2001). Preliminary analysis of microsatellite markers derived from sugarcane expressed sequence tags (ESTs). Genetics and Molecular Biology 24, 155-159.
Hash CT, Bhasker Raj AG, Lindup S, Sharma A, Beniwal CR, Folkertsma RT, Mahalakshmi V, Zerbini E, Blümmel M (2003). Opportunities for marker-assisted selection (MAS) to improve the feed quality of crop residues in pearl millet and sorghum. Field Crops Research 84, 79-88.
Jones ES, Liu CJ, Gale MD, Hash CT, Witcombe JR (1995). Mapping quantitative trait loci for downy mildew resistance in pearl millet. Theoretical and Applied Genetics 91, 448-456.
Jones ES, Breese WA, Liu CJ, Singh SD, Shaw DS, Witcombe JR (2002). Mapping quantitative trait loci for resistance to downy mildew in pearl millet: Field and glasshouse screens detect the same QTL. Crop Science 42, 1316-1323.
Kantety RV, Rotal ML, Matthews DE, Sorrells ME (2002). Data mining for simple sequence repeats in expressed sequence tags from barley, maize, rice, sorghum and wheat. Plant Molecular Biology 48, 501-510.
Liu CJ, Witcombe JR, Pittaway TS, Nash M, Hash CT, Busso CS, Gale MD (1994). An RFLP-based genetic map of pearl millet (Pennisetum glaucum). Theoretical and Applied Genetics 89, 481-487.
Miyao A, Zhong HS, Monna L, Yano M, Yamamoto K, Havukkala I, Minobe Y, Sasaki T (1996). Characterization and genetic mapping of simple sequence repeats in the rice genome. DNA Research 3, 233-238.
Morgan RN, Wilson JP, Hanna WW, Ozais-Akins P (1998). Molecular markers for rust and pyricularia leaf spot disease resistance in pearl millet. Theoretical and Applied Genetics 96, 413-420.
Qi X, Lindup S, Pittaway TS, Allouis S, Gale MD, Devos KM (2001). Development of simple sequence repeat markers from bacterial artificial chromosomes without subcloning. BioTechniques 31, 355-361.
Qi X, Pittaway TS, Lindup S, Liu H, Waterman E, Padi FK, Hash CT, Zhu J, Gale MD, Devos KM (2004). An integrated genetic map of pearl millet, Pennisetum glaucum. Manuscript communicated to Genetics.
Yadav RS, Hash CT, Bidinger FR, Cavan GP, Howarth CJ (2002). Quantitative trait loci associated with traits determining grain and stover yield in pearl millet under terminal drought-stress conditions. Theoretical and Applied Genetics 104, 67-83.
Yadav RS, Bidinger FR, Hash CT, Yadav YP, Yadav OP, Bhatnagar SK, Howarth CJ (2003). Mapping and characterization of QTL × E interactions for traits determining grain and stover yield in pearl millet. Theoretical and Applied Genetics 106, 512-520.
Yadav RS, Hash CT, Bidinger, FR, Devos KM, Howarth CJ (2004). Genomic regions associated with grain yield and aspects of post-flowering drought tolerance in pearl millet across stress environments and tester background. Euphytica (in press).



