Home    About    Publications    Services    Contact   
   
    Home     ICSC2004     Plenary     Symposia     Poster     Author Index     Conference Information  
Login Login
Logout Register
Print Friendly Print Friendly
  Home > Effectiveness of four cry genes in transgenic potato for conferring resistance to potato tuber moth

Previous PageTable Of ContentsNext Page

Effectiveness of four cry genes in transgenic potato for conferring resistance to potato tuber moth

S. Meiyalaghan1, 2, M.M. Davidson1, M.G.F. Takla1, 2, S.D. Wratten2 and A.J. Conner1, 2

1New Zealand Institute for Crop & Food Research Ltd, Private Bag 4704, Christchurch, New Zealand
2
National Centre for Advanced Bio-Protection Technologies, P.O. Box 84, Lincoln University, Canterbury, New Zealand

Abstract

Populations of transgenic lines of potato (Solanum tuberosum L.) cultivar Iwa have been developed for each of four cry genes under the transcriptional control of the CaMV 35S promoter. The transgenic status of these lines was confirmed by multiplex PCR with an endogenous potato actin gene as an internal control. Bioassays against neonate larvae of the potato tuber moth, Phthorimaea operculella (Zeller), demonstrated that all four cry genes were effective in conferring improved resistance to PTM larvae. The transgenic lines with cry1Ac9 or cry9Aa2 genes had a similar level of resistance, with a substantially reduced larval growth and with very few larvae developing to pupation. Potato lines transgenic for a cry1Ba1 gene were more effective in PTM control, with a greater reduction in larval growth and a higher mortality. The most effective control of PTM larvae was exhibited in potatoes transgenic for a cry1Ca5 gene which resulted in 100% mortality.

Media summary

The effectiveness of four cry genes to confer insect resistance in potatoes is reported as a basis for an additional component to integrated pest management.

Key Words

GM potatoes, insect resistance, genetic engineering, transformation

Introduction

The potato tuber moth, Phthorimaea operculella (Zeller) (PTM) is one of the most economically damaging insect pests of potatoes. The larvae mine the foliage, stems and tubers in the field and tubers in storage (Raman and Palacios 1982). Current control methods for PTM in potatoes include biological control, cultural management practices and the use of broad-spectrum insecticides. Insecticides are the primary strategy used to control this pest by most countries cultivating potatoes. The general use of insecticides, however, is limited by high cost, development of insect resistance to insecticides, persistence of residues in tubers and the environment, and destruction of beneficial organisms. To contribute an additional component to integrated pest management, we have investigated the development of transgenic potatoes with PTM resistance. The cloning of cry genes from Bacillus thuringiensis and their transfer and expression in plants is a well established approach to develop plants resistant to specific insect pests (Schuler et al. 1998).

Potato lines transgenic for a cry1Ac9 gene under transcriptional control of the CaMV 35S promoter have improved resistance to PTM larvae (Davidson et al. 2002, 2004). In this paper, this research is extended and the relative efficacy of four different cry genes to confer resistance to PTM larvae in transgenic potato plants is described.

Materials and Methods

Potato transformation

The coding regions of modified cry1Ac9 (Beuning et al. 2001), cry1Ba1 (Voisey et al. personal communication), cry1Ca5 (Strizhov et al. 1996) and cry9Aa2 (G14; Gleave et al. 1998) genes were individually cloned into pART7 (Gleave 1992) to produce 35S promoter-cry-ocs terminator chimeric genes. Each chimeric gene was inserted as a NotI fragment into the binary vector pART27 (Gleave 1992), then transferred to Agrobacterium. The nos-nptII-nos chimeric gene on the binary vectors was used as a selectable marker conferring resistance to kanamycin for the transformation of potato (cv. Iwa) as previously described (Barrell et al. 2002). All the regenerated transgenic lines were transferred to a containment greenhouse and grown as previously described (Conner et al. 1994).

Screening of putative transformed lines using PCR

Genomic DNA was isolated from in vitro shoots of putative transgenic and control plants as described by Davidson et al. (2004). DNA was amplified in a polymerase chain reaction (PCR) containing primers specific for the transgene of interest multiplexed with primers for the endogenous potato actin gene as an internal control (Table 1). PCRs were carried out in a Mastercycler (Eppendorf, Hamburg, Germany). The reactions included 2.5 µl 10x buffer (750 mM Tris-HCl (pH 8.8), 200 mM (NH4)2SO4, 0.1 % (v/v) Tween® 20), 1.5 µl 25 mM MgCl2, 2.5 µl dNTP (at 2 mM each of dATP, dCTP, dGTP, dTTP), 0.25 µl Red Hot® DNA polymerase at 5 U/µl (Advanced Biotechnologies, Surrey, U.K.), 0.5 µl of each primer (at 10 µM), 1.0 µl of DNA (10-50 ng) and water to a total volume of 25 µl. The amplification conditions for PCR were: 1 min at 93°C, followed by 35 cycles of 30 s 92°C, 30 s 58°C, 90 s 72°C followed by a 6 min extension at 72°C. The annealing temperature for the nptII and cry1Ac9 genes was 60°C. Amplified products were separated by electrophoresis in a 2% agarose gel and visualized under UV light after staining with ethidium bromide.

Table 1. Primers and expected product size for PCR of each gene.

Target gene

Forward primer (5’ to 3’)

Reverse primer (5’ to 3’)

Product size(bp)

cry1Ca5

CGATGAGTACGCTGATCACTG

TTTCTGATTGCGCTGCTC

293

cry1Ac9

GCCACAGAATAACAACGTGC

GCATACCGTACACGAACTCG

359

cry1Ba1

TCACCCAAATCCCTATGGTC

TAAAGAGAGCGTTGACAGCC

476

cry9Aa2

GCACGGAATTATTGGCGCTTC

CACGATGTCCAACACCATCAA

826

nptII

ATGACTGGGCACAACAGACAATCGGCTGCT

CGGGTAGCCAACGCTATGTCCTGATAGCGG

612

Actin

GATGGCAGAAGGCGAAGATA

GAGCTGGTCTTTGAAGTCTCG

1069

Insect bioassay

The 3-5 terminal leaflets from the youngest, fully expanded leaves were excised and placed in a 250 ml plastic container containing filter paper (Whatman No. 1, 75 mm diameter). Five PTM neonate larvae were weighed and placed on the leaflets in each container. Leaf material from each of three replicate plants arranged in a randomized block design on a greenhouse bench were placed in separate containers. The containers were sealed with lids and kept at 20 ± 3°C. Larvae were transferred to fresh leaves after 4 days. The surviving larvae were removed after 9 days and weighed individually. A growth index (GI) for each larva was calculated as GI = loge(final weight/mean initial weight). Full details are described by Davidson et al. (2002).

Results and Discussion

A total of 94 putative transgenic potato lines with kanamycin resistance (19-31 lines per cry gene) were regenerated into plants. The presence of the nptII and cry genes in these lines was confirmed using multiplex PCR with an endogenous actin gene to allow failed reactions to be conveniently distinguished from a non-transgenic line. PCR products from representative lines are illustrated in Figure 1. All 94 putative transgenic lines were PCR positive for both the nptII and cry genes, and 90 of these lines exhibited resistance to PTM (Table 2).

A

B

Figure 1. PCR analysis of putative transgenic lines. A. Multiplex PCR with nptII primers producing an expected 612 bp product and the actin primers as an internal control producing product 1069 bp. B Multiplex PCR with the primers specific for the cry gene of interest producing an expected 293bp for cry1Ca5 (lane2, 3); 359bp for cry1Ac9 (lane 4, 5); 476bp for cry1Ba1 (lane 6, 7); 826bp for cry9Aa2 (lane 8, 9) and the actin primers. Lanes 1 and 10, 100 bp molecular ruler 10380-012 and 1 kb plus molecular ruler 10787-018 (Invitrogen, Carlsbad, California) size markers respectively; lane 11, non-transgenic Iwa control; lane 12, no DNA template control.

Two constraints when developing transgenic lines of clonal crops such as potato are the marked variation in the expression level of the transferred gene between independently derived lines (position effects) and the atypical phenotypes that are frequently observed among plants regenerated from cell culture (somaclonal variation). It is important to produce a large number of independently selected transgenic lines to allow the recovery of several lines with the desired level of transgene expression, as well as a phenotypically normal appearance and yield performance (Conner and Christey 1994). To compare the relative effectiveness of the four cry genes we have selected five transgenic lines that have the highest resistance to PTM larvae and a normal “phenotypic appearance” from the populations of transgenic lines for each gene. The GI of surviving PTM larvae relative to non-transgenic Iwa control plants is illustrated in Figure 2. The GI for surviving larvae was lower for the lines with a cry1Ba1 gene than for larvae on foliage from lines containing either a cry1Ac9 or cry9Aa2 gene. The GI on lines with the cry1Ca5 gene were all zero, due to 100% mortality of the larvae. Larval mortality on foliage of the five lines with the cry1Ba1 gene was also high and ranged from 54-93%. For the lines with the cry1Ac9 and cry9Aa2 genes larvae mortality over the 9 day bioassay was low and ranged from only 0-20%, although it was rare for larvae raised on these lines to develop through to pupation.

Table 2. Summary of PCR analyses and PTM larvae bioassay on putatively transformed ‘Iwa’ potato lines.

Chimeric gene

No. of putatively transformed lines1

No. of lines PCR +ve for the nptII gene

No. of lines PCR +ve for the cry gene

No. of lines resistant to PTM larvae2

35S-cry1Ac9-ocs
35S-cry1Ba1-ocs
35S-cry1Ca5-ocs
35S-cry9Aa2-ocs

24
20
19
31

24
20
19
31

24
20
19
31

21
19
19
31

1Potato lines exhibiting root development on culture medium supplemented with 50 mg/l kanamycin
2
GI of PTM larvae significantly lower (P<0.05) than the GI on non-transgenic Iwa potato plants

Figure 2. Growth indices (GI) of potato tuber moth (PTM) larvae fed foliage of transgenic potato lines expressed as a percentage of the larval GI on control foliage for the non-transgenic Iwa potato.

After nine days extensive leaf damage from the mining activity of PTM larvae was observed on the leaves of the non-transgenic Iwa controls (Figure 3). Very minute or no larval mines were observed on the leaves of lines transgenic for the cry1Ca5 gene. Likewise, very little damage was observed on the leaves of lines with the cry1Ba1 gene. In comparison, transgenic lines with the cry1Ac9 and cry9Aa2 genes had more obvious damage, although, this was still minimal compared with the non-transgenic controls.

In conclusion, all four cry genes were effective in conferring improved resistance to PTM larvae. Transgenic lines containing either the cry1Ac9 or cry9Aa2 genes were similar in their level of resistance to PTM larvae. The cry1Ba1 gene was more effective, both in terms of GI of the PTM larvae and mortality. The most effective control of PTM larvae in transgenic potatoes was provided by the cry1Ca5 gene which resulted in 100% mortality.

A

B

C

D

E

Figure 3. Leaf bioassay comparing control line (A) and transgenic lines expressing cry1Ca5 (B), cry1Ba1 (C), cry1Ac9 (D) and cry9Aa2 (E).

Acknowledgments

We thank Andrew Gleave (HortResearch) for the vectors with cry1Ac9 and cry9Aa2 genes, Christine Voisey (AgResearch) for the cry1Ba1 gene, Jill Reader for maintaining the greenhouse plants and Jeanne Jacobs for helping to establish PCR protocols and her comments on earlier drafts of the manuscript.

References

Barrell PJ, Shang YJ, Cooper PA and Conner AJ (2002). Alternative selectable markers for potato transformation using minimal T-DNA vectors. Plant Cell, Tissue and Organ Culture 70, 61-68.

Beuning LL, Mitra DS, Markwick NP and Gleave AP (2001). Minor modifications to the cry1Ac9 nucleotide sequence are sufficient to generate transgenic plants resistant to Phthorimea operculella. Annals of Applied Biology 138, 281-292.

Conner AJ and Christey MC (1994). Plant breeding and seed marketing options for the introduction of transgenic insect-resistant crops. Biocontrol Science and Technology 4, 463-473.

Conner AJ, Williams MK, Abernethy DJ, Fletcher PJ and Genet RA (1994). Field testing of transgenic potatoes. New Zealand Journal of Crop and Horticultural Science 22, 361-371.

Davidson MM, Jacobs JME, Reader JK, Butler RC, Frater CM, Markwick NP, Wratten SD and Conner AJ (2002). Development and evaluation of potatoes transgenic for a cry1Ac9 gene conferring resistance to the potato tuber moth. Journal of the American Society for Horticultural Science 127, 590-596.

Davidson MM, Takla MFG, Jacobs JME, Butler RC, Wratten SD, and Conner AJ (2004). Transformation of New Zealand potato cultivars with a cry1Ac9 gene confers resistance to the potato tuber moth. New Zealand Journal of Crop and Horticultural Science 32, 39-50.

Gleave AP (1992). A versatile binary vector system with a T-DNA organizational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Molecular Biology 20, 1203-1207

Gleave AP, Mitra DS, Markwick NP, Morris BAM and Beuning LL (1998). Enhanced expression of the Bacillus thuringiensis cry9Aa2 gene in transgenic plants by nucleotide sequence modification confers resistance to potato tuber moth. Molecular Breeding 4, 459-472.

Raman KV and Palacios M (1982). Screening potatoes for resistance to potato tuberworm. Entomological Society of America 75, 47-49.

Schuler TH, Poppy GM, Kerry BR and Denholm I (1998). Insect-resistant transgenic plants. Trends in Biotechnology 16, 168-175.

Strizhov N, Keller M, Mathur J, Koncz-Kálmán Z, Bosch D, Prudovsky E, Schell J, Sneh B, Koncz C and Zilberstein A (1996). A synthetic cryIC gene, encoding a Bacillus thuringiensis δ-endotoxin, confers Spodoptera resistance in alfalfa and tobacco. Proceedings of the National Academy of Sciences USA 93, 15012-15017.

Previous PageTop Of PageNext Page

14th Australian Agronomy Conference 21-25 September 2008, Adelaide, SA [more...]

5th International Crop Science Congress 10-15 September 2008, Adelaide, SA [more...]

See The Regional Institute homepage for details of other conferences and events [more...]

Media releases from the Congress

Congress Case Study
Find out how we managed the publishing process?

Congress Feedback Responses from the online evaluation completed after the Congress.

Copyright © 2004. New directions for a diverse planet: Proceedings of the 4th International Crop Science Congress
Brisbane, Australia, 26 Sep – 1 Oct 2004 | ISBN 1 920842 20 9 |
www.cropscience.org.au